View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_high_22 (Length: 324)
Name: NF1780_high_22
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 7e-83; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 146 - 313
Target Start/End: Complemental strand, 10664975 - 10664808
Alignment:
| Q |
146 |
cctcttggaatagtttaacacacttctgcaattggcatggaatcacatgcaaccccttactattatatcagttgcactcaatgattttaatggctctttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10664975 |
cctcttggaatagtttaacacacttctgcaattggcatggaatcacatgcaaccccttactattgtatcagttgcactcaattattttaatggctctttt |
10664876 |
T |
|
| Q |
246 |
ccacccagtatgttcaacaccctctccaatctcaggtctaatccctatttcacttgcaaatgcttcat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10664875 |
ccacccagtatgttcaacaccctctccaatctcaggtctaatccctatttcacttgcaaatgattcat |
10664808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 18 - 196
Target Start/End: Original strand, 7190727 - 7190905
Alignment:
| Q |
18 |
gttatctcttctctttccttttaactccgtacaaaaaacaatgacctctacattaggaagcgatacagataacttggcttttatcagatttaaacaatca |
117 |
Q |
| |
|
||||||| ||||| || |||| |||| | | ||||| ||| | || ||||||||||||| || || ||||||||||| || ||| || ||| ||||| |
|
|
| T |
7190727 |
gttatcttttctcattgctttcaacttcttccaaaacacatttacttctacattaggaactgagaccgataacttggcgttgctcaagttcaaagaatca |
7190826 |
T |
|
| Q |
118 |
atatctaatgattcatattgagttttggcctcttggaatagtttaacacacttctgcaattggcatggaatcacatgca |
196 |
Q |
| |
|
|||||||||||| ||||| || | ||||||||||||||||||| ||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
7190827 |
atatctaatgatccatatggaatcttggcctcttggaatagttcaactcacttctgcaagtggtatggaatcacatgca |
7190905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 10654686 - 10654510
Alignment:
| Q |
18 |
gttatctcttctctttccttttaactccgtacaaaaaacaatgacctctacattaggaagcgatacagataacttggcttttatcagatttaaacaatca |
117 |
Q |
| |
|
|||||||||||||||| || | |||| || ||||| ||||| |||||||| ||||||| | | |||||| |||| || || ||| ||| ||| ||||| |
|
|
| T |
10654686 |
gttatctcttctctttactctcaactttgtccaaaacacaattacctctaccttaggaaacaagacagattacttagcgttactcaaattcaaagaatca |
10654587 |
T |
|
| Q |
118 |
atatctaatgattcatattgagttttggcctcttggaatagtttaacacacttctgcaattggcatggaatcacatg |
194 |
Q |
| |
|
|| |||||||| ||||| || | |||||||||||||||| || || |||| ||| |||||||||||||| ||||| |
|
|
| T |
10654586 |
atttctaatgacccatatggaatcttggcctcttggaatacttcaaatcactactgtaattggcatggaattacatg |
10654510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 148 - 201
Target Start/End: Complemental strand, 19608219 - 19608166
Alignment:
| Q |
148 |
tcttggaatagtttaacacacttctgcaattggcatggaatcacatgcaacccc |
201 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
19608219 |
tcttggaatagttcaacacacttttgcaattggcatggaatcacatgcagcccc |
19608166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 213 - 277
Target Start/End: Complemental strand, 10661857 - 10661793
Alignment:
| Q |
213 |
tcagttgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctccaatct |
277 |
Q |
| |
|
||||||| || ||||||||||||||| ||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
10661857 |
tcagttggacccaatgattttaatggatctcttccatccaatatgttcaacaccctctccaatct |
10661793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 218 - 277
Target Start/End: Original strand, 7191447 - 7191506
Alignment:
| Q |
218 |
tgcactcaatgattttaatggctcttttccacccagtatgttcaacaccctctccaatct |
277 |
Q |
| |
|
|||| ||||| |||||||||| ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
7191447 |
tgcattcaataattttaatggatctcttccacccaatatgttcaacaccctctccaatct |
7191506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 10598944 - 10598993
Alignment:
| Q |
148 |
tcttggaatagtttaacacacttctgcaattggcatggaatcacatgcaa |
197 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||||||||||||||| |||||| |
|
|
| T |
10598944 |
tcttggaatagttcaactcacttttgcaattggcatggaatcatatgcaa |
10598993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 201
Target Start/End: Complemental strand, 9838664 - 9838629
Alignment:
| Q |
166 |
cacttctgcaattggcatggaatcacatgcaacccc |
201 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9838664 |
cacttctgcaactggcatggaatcacatgcaacccc |
9838629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University