View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_high_50 (Length: 209)
Name: NF1780_high_50
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 38380822 - 38380894
Alignment:
| Q |
17 |
cacagattataaattcaaaaaataaaataacgaaagaaaggaagcgaacgaacctgggagcggaagcttcggt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38380822 |
cacagattataaattcaaaaaataaaataacgaaagaaacgaagcgaacgaacctgggagcggaagcttcggt |
38380894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 38380941 - 38380988
Alignment:
| Q |
141 |
cgctcttgatctttt-gtccttcccgctaatggagagggacatgtggg |
187 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38380941 |
cgctcttgatctttttgtccttcccgctaatggagagggacatgtggg |
38380988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University