View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_11 (Length: 392)
Name: NF1780_low_11
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 15 - 138
Target Start/End: Original strand, 5115154 - 5115277
Alignment:
| Q |
15 |
ataatactttcttttgttggacggatgaagtaggcaacagtggttcttgcagtgcctgaatttgtcacaacacggtgctctgctcctatcagccttccat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5115154 |
ataatactttcttttgttggacggatgaagtaggcaacagtggttcttgcagtgcctgaatttgtcacaacacggtgctctgctcctatcagccttccat |
5115253 |
T |
|
| Q |
115 |
tactaatgatctacacattagtga |
138 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5115254 |
tactaatgatctacacattagtga |
5115277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 5115314 - 5115360
Alignment:
| Q |
331 |
tatgttcaatatccatttgagctcaatcatttgttattgttactaat |
377 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5115314 |
tatgttcaatatccatttgagctcaatcacttgttattgttactaat |
5115360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University