View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_19 (Length: 345)
Name: NF1780_low_19
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 19 - 339
Target Start/End: Complemental strand, 27878604 - 27878284
Alignment:
| Q |
19 |
ggcaaaagggtcaaagaaagttttgaagaaacttgatgaggttcttgaaaagtatagtcttctttctgttgagaaggtgaagggtgttaaagggtgggag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878604 |
ggcaaaagggtcaaagaaagttttgaagaaacttgatgaggttcttgaaaagtacagtcttctttctgttgagaaggtgaagggtgttaaagggtgggag |
27878505 |
T |
|
| Q |
119 |
gttttggagaaaaaggaagatgtagaggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878504 |
gttttggagaaaaaggaagatgtagaggaaaattctgctgctgcttattggacaacgttggcaccaaacgtggaggattatagtggaagatttggtagat |
27878405 |
T |
|
| Q |
219 |
ggattgctgcaggttcaggacaaatgatcagaggaattttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27878404 |
ggattgctgcaggttcaggacaaatgatcagaggaattttgtggtgcggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaagag |
27878305 |
T |
|
| Q |
319 |
gttgcaacctggttcatctca |
339 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
27878304 |
gttgcaacctggttcttctca |
27878284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 254 - 317
Target Start/End: Complemental strand, 31870249 - 31870186
Alignment:
| Q |
254 |
attttgtggtgtggtgatgttactgttgatagattgaaatggggtgatgatttcatgaagaaga |
317 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |||| | |||||||||| |
|
|
| T |
31870249 |
attttgtggtgtggggatgttactgttgataggttgaaatggggtaatgagattatgaagaaga |
31870186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University