View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_31 (Length: 290)
Name: NF1780_low_31
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 3 - 156
Target Start/End: Complemental strand, 1633278 - 1633125
Alignment:
| Q |
3 |
cattagataagaatgaaaatctacttttgttctttttcttttcagaaaactattttgggtttaaagtttaaatttcagttcttccttccagttaaccatg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1633278 |
cattagataagaatgaaaatctacttttgttctttttcttttcagaaaactattttgggtttaaagtttaaatttcagttcttccttccggttaaccatg |
1633179 |
T |
 |
| Q |
103 |
acaaactatcatcattagttattattagagctataaaaatcagttagaatatag |
156 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1633178 |
agaaacgatcatcattagttattattagagctataaaaatcagttagaatatag |
1633125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 202 - 274
Target Start/End: Complemental strand, 1633085 - 1633013
Alignment:
| Q |
202 |
aataatttattgttagactttatttagctctaacttaaacttcggattaatggagacttattcccctggaaac |
274 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1633085 |
aataatttattgttagactttatttatctctaacttaaacttcggattaatggagactttatcccctggaaac |
1633013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University