View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_36 (Length: 256)
Name: NF1780_low_36
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 186
Target Start/End: Original strand, 24831527 - 24831702
Alignment:
| Q |
11 |
aatgcagattatacaaaacataagtgaataagatgaaatggaaaggnnnnnnnggatgaaagacgaattaatccttccttgtgtgagaaactaacgggga |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24831527 |
aatgcagatcatacaaaacataagtgaataagatgaaatggaaaggaaaaaaaggatgaaagacgaattaatccttccttgtgtgagaaactaacgggga |
24831626 |
T |
 |
| Q |
111 |
ggtagaaattaaaatgggnnnnnnngcataacttgctcacattaactctaattgattctttttagatcagtctaat |
186 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
24831627 |
ggtggaaattaaaatgggaaaaaaagcataacttgctcacattaactctaattgattcttttcagatcactctaat |
24831702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University