View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_40 (Length: 250)
Name: NF1780_low_40
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_40 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 74 - 250
Target Start/End: Complemental strand, 5821547 - 5821371
Alignment:
| Q |
74 |
aatttaggtatatttctaacacttagcgacaaattaaaataaagtgacattttgtcatctctttaatattgcgattcatctttttagtagttgacacttg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5821547 |
aatttaggtatatttctaacacttagcgacaaattaaaataaagtgacattttgtcatctctttaatattgcgattcatctttttagtagttgacacttg |
5821448 |
T |
 |
| Q |
174 |
ataccattgtttcaaaaaattgaaactgagatgttttaagttcaactactttaaactgtttgaacaaggatcaaatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5821447 |
ataccattgtttcaaaaaattgaaactgagatgttttaagttcaactactttaaaccgtttgaacaaggatcaaatt |
5821371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 90
Target Start/End: Complemental strand, 5821593 - 5821563
Alignment:
| Q |
60 |
ttacattgttttctaatttaggtatatttct |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5821593 |
ttacattgttttctaatttaggtatatttct |
5821563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University