View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_41 (Length: 240)
Name: NF1780_low_41
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 30769593 - 30769826
Alignment:
| Q |
1 |
ccaacaaacctatcctgaatcggtcgagtctttatcatcgccaccaccacagccaccaccacgatcacgcgttaatgaaacaatgaacgacgattccttc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769593 |
ccaacaaaactatcctgaatcggtcgagtctttatcatcgccaccaccacagccaccaccacgatcacgcgttaatgaaacaatgaacgacgattccttc |
30769692 |
T |
|
| Q |
101 |
cctaatgtccccggaggcaagcttcggctcatgtgcagctacggaggccacataatgccgcgccctcacgataagtctttatgttatgtaggcggtgaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
30769693 |
cctaatgtccccggaggcaagcttcggctaatgtgcagctacggaggccacataatgccgcgccctcatgataagtctctatgttatgtaggtggtgaca |
30769792 |
T |
|
| Q |
201 |
ccagaatcgtggtcgtggatcgcagttcttctct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30769793 |
ccagaatcgtggtcgtggatcgcagttcttctct |
30769826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University