View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1780_low_52 (Length: 213)
Name: NF1780_low_52
Description: NF1780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1780_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 38000529 - 38000351
Alignment:
| Q |
20 |
aggcatccaatacaaatatcatggaatgatggagtgaatggcgaggagcatggtaattgaatgagatttagttaatcaatgattgtcttgactcttgagg |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38000529 |
aggcaaccaatacaaatatcatggaatgatggagtgaatggcgaggagcatggtaattgaatgagatttagttaatcaatgattgtcttgactcttgagg |
38000430 |
T |
|
| Q |
120 |
catggtgagagagaaggaaaatttggtcgattgaagaaaatgtgtcttaattgagagaagggaaattgtggaagaaaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38000429 |
catggtgagagagaaggaaaatttggtagattgaagaaaatgtgtcttaattgagagaagggaaattgtggaagaaaat |
38000351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University