View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_high_10 (Length: 521)
Name: NF17811_high_10
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 11758489 - 11758716
Alignment:
| Q |
1 |
cagttcattgattctggtagcgagttttcacaaggatccgttggtgaaactccttctcatacttattcgttgcttcttcgataccgcgacgaattcgcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11758489 |
cagttcattgattctggtagcgagttttcacaaggatccgttggtgaaactccttctcatacttattcgttgcttcttcgataccgcgacgaattcgcaa |
11758588 |
T |
 |
| Q |
101 |
agctaggttctccggttaaagctacttcaattgttgtagaagatttttctcttcataacaatgtacgttttgtttcatcaatttcttagttcaaaatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11758589 |
agctaggttctccggttaaagctacttcaattgttgtagaagatttttctcttcataacaatgtacgttttgtttcatcaatttcttagttcaaaatgtt |
11758688 |
T |
 |
| Q |
201 |
aataatatgctaattattctagtttaac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
11758689 |
aataatatgctaattattctagtttaac |
11758716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 259 - 443
Target Start/End: Original strand, 11758747 - 11758931
Alignment:
| Q |
259 |
cgaggtttgaagatattgatgatgaagagagttaccagatgctgagaaagagagaacgaaggaaagctttcatgtggaattatggagaaagatatttctc |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11758747 |
cgaggtttgaagatattgatgatgaagagagttaccagatgctgagaaagagagaacgaaggcaagctttcatgtggaattatggagaaagatatttctc |
11758846 |
T |
 |
| Q |
359 |
tgcaacggattttgcggaagtatttcagcaacgttcacgaatggttcattggattgttgaggtagtttactctataactacattc |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11758847 |
tgcaacggattttgcggaagtatttcagcaacgttcacgaatggttcattggattgttgaggtagtttactctataactacattc |
11758931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University