View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_high_23 (Length: 375)
Name: NF17811_high_23
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 15 - 358
Target Start/End: Complemental strand, 47350330 - 47349990
Alignment:
| Q |
15 |
atgaaggagtggggaaggcccatacagcgtcagtattgcttcaaaggctgttttcatcacataaaaggatttatttacagtgctgaagctgcagaatgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350330 |
atgaaggagtggggaaggcccatacagcgtcagtattgcttcaaaggctgttttcatcacataaaaggatttatttacagtgctgaagctgcagaatgta |
47350231 |
T |
|
| Q |
115 |
cccgtttacccatcaatgtgttcactgcacattcaatgcacatattcattcatataataatatcctagcaaaaaaccatatactaaatattatttttact |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350230 |
cccgtttacccatcaatgtgttcactgcacattcaatgcacatattcattcatataata---tcctagcaaaaaaccatatactaaatattatttttact |
47350134 |
T |
|
| Q |
215 |
agacatacgggtcatggtccattaaatgtatcattgtcacgtcttatttcttcatatttgaccttttcaacacaataatgtaacataaacccatatcatg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47350133 |
agacatacgggtcatggtccattaaatgtatcattgtcacgtcttatttcttcatatttgacctttgcaacacaataatgtaacataaacccatatcatg |
47350034 |
T |
|
| Q |
315 |
tggtgtactttttaggtagcacaatattctagcatatccgaaac |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350033 |
tggtgtactttttaggtagcacaatattctagcatatccgaaac |
47349990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University