View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_high_46 (Length: 266)
Name: NF17811_high_46
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_high_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 56 - 247
Target Start/End: Complemental strand, 33751324 - 33751133
Alignment:
| Q |
56 |
ttatattcttatccttattaaaaaacaatgtactcattgaagctgaatatataaccctttaagctaaaaagacaaaatcagtgaacagaactagtattta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751324 |
ttatattcttatccttattaaaaaacaatgcactcattgaagctgaatatataaccctttaagctaaaaagacaaaatcagtgaacagaactagtattta |
33751225 |
T |
|
| Q |
156 |
tactataatataattcaacaaagccacacattaagtagaatattttagaaagcagattacattaaaatcacgatttgcacttgcaggtatat |
247 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33751224 |
tactataatataattcaataaagccacacattaagtacaatattttagaaagcagattacattaaaatcacgatttgcagttgcaggtatat |
33751133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 245
Target Start/End: Complemental strand, 32576023 - 32575995
Alignment:
| Q |
217 |
ttaaaatcacgatttgcacttgcaggtat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32576023 |
ttaaaatcacgatttgcacttgcaggtat |
32575995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University