View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_high_52 (Length: 246)
Name: NF17811_high_52
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_high_52 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 34479365 - 34479579
Alignment:
| Q |
14 |
atgaagaaaagtataaaacattaaacactaatgtcaattttgacaaggtgtattttaatttgatgtctttgtcnnnnnnnnnnnnnnnnnnnnnnnnnca |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34479365 |
atgaacaaaagtataaaacattaaacactaatgtcaattttgacaaggtgtattttaatttgatgtctttgtcaaaggaaaagaaaaaagagaagaaaca |
34479464 |
T |
|
| Q |
114 |
ttttcattgtaatcaaattgattaaaatattgctttcaagttttgttgtggacatgccagttaatttattcttctggatggtatgagatagtcagtcagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
34479465 |
ttttcattgtaatcaaattgattaaaatattgctttcaagttttgttgtggacatgccagttaatttattcttctggatggtatgacacagtcagtcagt |
34479564 |
T |
|
| Q |
214 |
ttcttgagctatttt |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34479565 |
ttcttgagctatttt |
34479579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 114 - 170
Target Start/End: Original strand, 34489794 - 34489852
Alignment:
| Q |
114 |
ttttcattgtaatcaaattgattaaaatat--tgctttcaagttttgttgtggacatgc |
170 |
Q |
| |
|
||||||||| ||||| ||||||||| |||| |||||| |||||||||||||||||||| |
|
|
| T |
34489794 |
ttttcattgcaatcagattgattaagatatattgctttaaagttttgttgtggacatgc |
34489852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University