View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_32 (Length: 349)
Name: NF17811_low_32
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 332
Target Start/End: Complemental strand, 8437894 - 8437571
Alignment:
| Q |
15 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437894 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
8437795 |
T |
 |
| Q |
115 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437794 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
8437695 |
T |
 |
| Q |
215 |
tt------aaatcaaatcaattgcttgttcatgtttgtattgatcataaacnnnnnnnnnnnnnnnnnnnngttaaggatttgtctcactgatttcattt |
308 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8437694 |
ttaaaatcaaatcaaatcaattgcttgttcatgtgtgtattgatcataaacatatttttgtgagatatatagttaaggatttgtctcactgatttcattt |
8437595 |
T |
 |
| Q |
309 |
ttcgaaagatatatccttatcttt |
332 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8437594 |
ttcgaaagatatatccttatcttt |
8437571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University