View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_34 (Length: 336)
Name: NF17811_low_34
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 12 - 319
Target Start/End: Complemental strand, 3675054 - 3674747
Alignment:
| Q |
12 |
attattctaatatgttccgtatgattcatagtttactgataagtggaatcttgtaaattggaccatagtatgtaaacacaatttgtacactataaatcct |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675054 |
attattctaatatgttt-gtatgattcatagtttactaataagtggaatcttgtaaattggaccatagtatgtaaacacaatttgtacactataaatcct |
3674956 |
T |
 |
| Q |
112 |
aaggttgaattattgaaaggtatagcatccgctcggcaatggtagccgtagacgtctcactgatcaaatctcgtgtgttatttgtttgcgt-ttttcttt |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3674955 |
aaggttgaattatagaaaggtatagcatccgctcggtaatggtagccgtagacgtctcactgatcaaatctcgtgtgttatttgtttgcgttttttcttt |
3674856 |
T |
 |
| Q |
211 |
tgagccgaggttgatgttctaacataatacaaacaggatactctgctactatgccatggtcaacaaggatgaaaatcgcattgggagctgctaaaggctt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3674855 |
tgagccgaggttgatgttctaacataatacaaacaggatactctgctactatgccatggtcaacaaggatgaaaatcgcattgggagctgctaaaggctt |
3674756 |
T |
 |
| Q |
311 |
agcatttct |
319 |
Q |
| |
|
||||||||| |
|
|
| T |
3674755 |
agcatttct |
3674747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University