View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_38 (Length: 305)
Name: NF17811_low_38
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 85 - 247
Target Start/End: Original strand, 50899245 - 50899407
Alignment:
| Q |
85 |
ttaaataaccctaatatttcattgccgtaggcactcacaacgtgaaaccgcttcatgttttgcaaaatcttaagccacaattcgattcaccttttcaaac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899245 |
ttaaataaccctaatatttcattgccgtagtcactcacaacgtgaaatcgcttcatgttttgcaaaatcttaagccacaattcgattcaccttttcaaac |
50899344 |
T |
 |
| Q |
185 |
tcaacctcgataaacgctgccatgagtttcttttaaccacctgtaggtatagttatatttgcg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50899345 |
tcaacctcgataaacgctgccatgagtttcttttaaccacctgtaggtatagttatatttgcg |
50899407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 2 - 80
Target Start/End: Original strand, 50899185 - 50899263
Alignment:
| Q |
2 |
gggagaaaaacagtgctcggttttcattttacgccggggaaaaatgggctttgcccgttattaaataactctaatattt |
80 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
50899185 |
gggagaaaaacagtgctcggtttccattttacgcgggggaaaaatgggcttggcccgttattaaataaccctaatattt |
50899263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University