View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_40 (Length: 300)
Name: NF17811_low_40
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 15 - 280
Target Start/End: Complemental strand, 41497885 - 41497620
Alignment:
| Q |
15 |
attattctcttaacgctctcaaagttgagctccgtgtatattttttgtgtgtgcttagacacatgttagactcttattattttagtcgactagttaaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497885 |
attattctcttaacgctctcaaagttgagctccgtgtatattttttgtgtgtgcttagacacatgttagactcttattattttagtcgactagttaaaca |
41497786 |
T |
 |
| Q |
115 |
aactaattggataatacttttactctaccttgggggagaagattcgctgcaaaattgtaaggaaaggttaagccatgagatttataacctaggtgagtct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497785 |
aactaattggataatacttttactctaccttgggggagaagattcactccaaaattgtaaggaaaggttaagccatgagatttataacctaggtgagtct |
41497686 |
T |
 |
| Q |
215 |
tagaatttggtttgaacttaactcaacacttcactctcgtaccaatttaaaatttgtgtcgagtta |
280 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41497685 |
tagaatttggtttgaacttaattcaacccttcactttcgtaccaatttaaaatttgtgtcgagtta |
41497620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University