View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_42 (Length: 298)
Name: NF17811_low_42
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 74 - 286
Target Start/End: Complemental strand, 41649867 - 41649655
Alignment:
| Q |
74 |
gcgagcaaaatatgtcatgtgaagagcagaattcaatttgtttcctctggcggtcatccatccgtcttttcttgttattccattttctcaaatgttgcac |
173 |
Q |
| |
|
||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41649867 |
gcgagcaaaatgtgccatatgaagagcagaattcaatttgtttcctctggcggtcatccatccgtcttttcttgttattccattttctcaaatgttgcac |
41649768 |
T |
 |
| Q |
174 |
atagtttcaataacaaaaatttcaatcagcatcaaagtaattttgtatggtgagagatgatagtttaattacgtcaaatcttaccggtactctctgaggc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41649767 |
atagtttcaataacaaaaatttcaatcagcatcaaggtaattttgtatggtgagagatgatagtttaattacgtcaaatcttactagtactctctgaggc |
41649668 |
T |
 |
| Q |
274 |
tgagcttgatgat |
286 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
41649667 |
tgagctagatgat |
41649655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University