View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_50 (Length: 271)
Name: NF17811_low_50
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_50 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 21 - 271
Target Start/End: Original strand, 27334 - 27584
Alignment:
| Q |
21 |
tgatatctcccattccatattggagggttgttcttcatggccaaggagttcatacagacccttagaagataatagcaatattcttggcttggcctacggc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
27334 |
tgatatctcccattccatattggagggttgttcttcatggccaaggagttcatacagacccttagaagataatagcaatattcttggcttggcctacgcc |
27433 |
T |
|
| Q |
121 |
tacttgtgtcaaacagcttagaacatttctaagtttgacttgttacaacttaaaataaacatgtgtccaaagtcattgctgattttacctttgatgactn |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27434 |
tacttgtgtcaaacagcttagaacatttctaagtttgacttgttacaacttaaaataaacatgtgtccaaagtcattgctgattttacctttgatgacta |
27533 |
T |
|
| Q |
221 |
nnnnnnggctgtgtccaacattcttgtgctagcacttgccaattccaatgg |
271 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27534 |
aaaaaaggccgtgtccaacattcttgtgctagcacttgccaattccaatgg |
27584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University