View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_54 (Length: 254)
Name: NF17811_low_54
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 46287321 - 46287559
Alignment:
| Q |
1 |
aaataaagcgcacacgcacacacaaaccaacctacgnnnnnnn-gaccccttgtgcataaaatcacaaaatgtccactcacatcaaatcatattcatccc |
99 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287321 |
aaataaagcgcacgcacacacacaaaccaacctacgaaaaaaaagaccccttgtgcataaaatcacaaaatgtccactcacatcaaatcatattcatccc |
46287420 |
T |
|
| Q |
100 |
attgctgccatcagcagtaatacaacattgattctcatcctttatctagtatgttcagacaccattgactagttatattacatgcaaggtttatttgaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287421 |
attgctgccatcagcagtaatacaacattgattctcatcctttatctagtatgttcagacaccattgactagttatattacatgcaaggtttatttgaca |
46287520 |
T |
|
| Q |
200 |
cacaaaggcagaagaactcgagacttgaaccccaccatc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46287521 |
cacaaaggcagaagaactcgagacttgaaccccaccatc |
46287559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University