View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_64 (Length: 242)
Name: NF17811_low_64
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 36502666 - 36502450
Alignment:
| Q |
16 |
catccttctccatttcctcaagcaccgaaaccgcagaatcaaaagaacccttttccaacaaagccttaatataagtattatacgaaaccaaatcaggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502666 |
catccttctccatttcctcaagcaccgaaaccgcagaatcaaaagaacccttttccaacaaagccttaatataagtattatacgaaaccaaatcaggttt |
36502567 |
T |
|
| Q |
116 |
cacagataactgaaccggaagcttcttaaaaagccgctcaacaacatcatattgcttcgaatgaagataagcagctaacaacgcattgagagaaagcaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36502566 |
cacagataactgaaccggaagcttcttaaaaagccgctcaacaacatcatactgcttcgaatgaagataagcagctaacaacgcattgagagaaagcaca |
36502467 |
T |
|
| Q |
216 |
gaacgctcacaggttct |
232 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
36502466 |
gaacgctcacagtttct |
36502450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University