View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17811_low_65 (Length: 240)
Name: NF17811_low_65
Description: NF17811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17811_low_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 32236025 - 32236221
Alignment:
| Q |
16 |
atgagtcacggaacttaattatgtgtaggtgttgaatgtttaatttcaatgttgtgcattcttttctttggggaggatccatactacttatgttttatgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32236025 |
atgagtcacggaacttaattatgtgtaggtgttgaatgtgtaatttcaatgttgtgcattcttttctttggggaggatccatactac-------ttatga |
32236117 |
T |
 |
| Q |
116 |
tattattggttggtgtgtcaagtatgagttaaatattctacatattagaaagnnnnnnnngtaaatgtgaaaaatatttggttaaatatttttgacccat |
215 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32236118 |
taggattggttggcgtgtcaagtatgagttaaatattct--atattagaaag-aaaaaaagtaaatgtg-aaaatatttggttaaatatttttgacccat |
32236213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University