View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17813_high_18 (Length: 360)
Name: NF17813_high_18
Description: NF17813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17813_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 13 - 342
Target Start/End: Complemental strand, 40831788 - 40831456
Alignment:
| Q |
13 |
aatatcatcactagtgttactttccacttaattataagatataaattctctttctgtgctgtgctaaatcaaactcaccttgctactgtctcttttttga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40831788 |
aatatcatcactagtgttactttccacttaattataagatataaattctctttctgtgctgtgctaaatcaaactcaccttgctactgtctcttttttta |
40831689 |
T |
|
| Q |
113 |
gtgtgatctactatactagacctgggatctctattctctcttttcaaggttattcactttaactaactctagatttctcaaatcatatttagattctgct |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40831688 |
gtgtgatctactataccagacctgggatctctattctctcttttcaaggttattcactttaactaactctagatttctcaaatcatatttagattctgct |
40831589 |
T |
|
| Q |
213 |
atca---nnnnnnngacccatttaccttacaactcaacatgtatataccaatcatatgatttcaaacatttgcattgtaaagttttgatttttataagct |
309 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40831588 |
atcattttttttttgacccatttaccttacaattcaacatgtatataccaatcatatgatttcaaacatttgcattgtaaagttttgatttttataagct |
40831489 |
T |
|
| Q |
310 |
aacttttctgggttttctcttttgctgatcata |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40831488 |
aacttttctgggttttctcttttgctgatcata |
40831456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University