View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17813_high_23 (Length: 265)
Name: NF17813_high_23
Description: NF17813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17813_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 37533523 - 37533745
Alignment:
| Q |
19 |
agtcgactgatatgaacaagaggttatcaattagtactacgaactagatgaggtgaagattaatcaacactgaatattgttgaaacttgaaaagcaaaat |
118 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37533523 |
agtcaactaatatgaacaagaggttatcaattagtactacgaactagatgaggtgaagattaatcaacactgaatattgttgaaacttgaaaagcaaaat |
37533622 |
T |
 |
| Q |
119 |
gaagagataggagacacgaattacaaggtgtgaaaacgaccatggctataatagaaaaggaagaatgagagagacctcacagttaatgacnnnnnnnctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37533623 |
gaagagataggagacacgaattacaaggtgtgaaaacgaccatggctataatagaaaaggaagaatgagagagacctcacagttaatgacaaaaaaactg |
37533722 |
T |
 |
| Q |
219 |
gggactactaattttgggattgt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37533723 |
gggactactaattttgggattgt |
37533745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University