View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_14 (Length: 402)
Name: NF17814_high_14
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 5 - 376
Target Start/End: Original strand, 33734927 - 33735297
Alignment:
| Q |
5 |
gatggacatcatcacaaggttacaccatcattttggtggtaattgatc-catttctaagtacactcacatcgctgcattaaaatcatagtacacgagctc |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33734927 |
gatggacttcatcacaaggttacaccatcattttggtggtaattgatcgcatttctaagtacactcgcatcgctgcattaaaatcatagtacacgagctc |
33735026 |
T |
 |
| Q |
104 |
taaggatgttgaaaccttcatgcacattctggtgaagttgcatggtatttcaaataatattgttttcgacaaggatcgggggtctttgctattcgtttct |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
33735027 |
taaggatgttgaaaccttcatacacattctggtgaagttgcatggtatttcaaataatattgttttcgataaggatcgggggtctttaatattcgtttct |
33735126 |
T |
 |
| Q |
204 |
ctcaaagaataattaagttgagtggcacaacctcgatcatcagatcctcctatcatcattaaagaaatggataatcggaagctttgaacaaatttttgga |
303 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735127 |
ctcaaa-ttttattaagttgagtggcacaacctcgatcatcagatcctcctatcatccttaaataaatggataatcggaagctttgaacaaatttttgga |
33735225 |
T |
 |
| Q |
304 |
attgtacttatgttcttctaaatggtcaaaccccaaattatggtcaagattactctattgaacgcaatactag |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
33735226 |
attgtacttatgttcttctaaatggtcaaacccc-aattttggtcaagattactctattggacgcaatactag |
33735297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University