View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_20 (Length: 340)
Name: NF17814_high_20
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 31 - 233
Target Start/End: Complemental strand, 7910123 - 7909921
Alignment:
| Q |
31 |
ttgatggttgtgtggacacaaatctcttttgcatctctaacagtctgccctgtaatgtgaaattgtgaatatcaatgtggttgcaactaatatatgacat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910123 |
ttgatggttgtgtggacacaaatctcttttgcatctctaacagtctgccctgtaatgtgaaattgtgaatatcaatgtggttgcaactaatatatgacat |
7910024 |
T |
 |
| Q |
131 |
agtgtcaaaagcactgtcaaatgataaggtattatttgaaagcaattatcaatgaaactgagatatgttattgaaagtcaccaacaaaagcactttctgc |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7910023 |
agtgtcaaaagcactgtcaaataataaggtattatttgaaagcaattatcaatgaaactgagatatgttattgaaagtcaacaacaaaagcactttctgc |
7909924 |
T |
 |
| Q |
231 |
atc |
233 |
Q |
| |
|
||| |
|
|
| T |
7909923 |
atc |
7909921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 7792985 - 7793045
Alignment:
| Q |
31 |
ttgatggttgtgtggacacaaatctcttttgcatctctaacagtctgccctgtaatgtgaa |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| ||||||| ||| || ||||||||||| |
|
|
| T |
7792985 |
ttgatggttgtgtggagacaaatctcttctgcatatctaacattctaccttgtaatgtgaa |
7793045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 77
Target Start/End: Original strand, 8514188 - 8514231
Alignment:
| Q |
34 |
atggttgtgtggacacaaatctcttttgcatctctaacagtctg |
77 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8514188 |
atggttgtgtggagacaaatctcttttgcatctctaaaagtctg |
8514231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University