View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_21 (Length: 337)
Name: NF17814_high_21
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 24 - 330
Target Start/End: Complemental strand, 43528716 - 43528408
Alignment:
| Q |
24 |
ataacattcttctgatcaatcaaaatcttcttcttcaagcttccgatcactctgaacattc--ctgcgcaaatcaatcatcacaattcgcaacacgcttc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43528716 |
ataacattcttctgatcaatcaaaatcttcttcttcaagcttccgatcactctgaacattcttctgcgcaaatcaatcatcacaattcgcaacacgcttc |
43528617 |
T |
|
| Q |
122 |
aattcatctcccttattatcatcaccactgttttctgcattcgattttcgttcttttaccgtttaattctctgaaatttgattaatcttttgtaggtgat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43528616 |
aattcatctcccttattatcatcaccactgttttctgcattcgattttcgttcttttaccgtttaattctctgaaatttgattaatcttttgtaggtgat |
43528517 |
T |
|
| Q |
222 |
ttctttgatcatcttcaacaatggattcaggtttgtggagttcttcttcaaagaccaaaatcagaacgcctttcccagaacgctttctccaccgaaagaa |
321 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43528516 |
ttctttgatcatcttcaacaatggattcgggttcgtggagttcttcttcaaagaccaaaatcagaacgcctttcccagaacgctttctccaccgaaataa |
43528417 |
T |
|
| Q |
322 |
ttcttctca |
330 |
Q |
| |
|
||||||||| |
|
|
| T |
43528416 |
ttcttctca |
43528408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University