View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_28 (Length: 257)
Name: NF17814_high_28
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 23 - 250
Target Start/End: Original strand, 43003492 - 43003719
Alignment:
| Q |
23 |
ctggtctttgatttcagttcacctagaggagtatgtgcctcttgttctagcatctttggttcgttctctaacacgctgcaagctgcctcaagacatgtct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003492 |
ctggtctttgatttcagttcacctagaggagtatgtgcctcttgttctagcatctttggttcgttctctaacacgctgcaagctgcctcaagacatgtct |
43003591 |
T |
|
| Q |
123 |
caagcacggtggttgttgagtcgtcgttatggactcttgcttaaagttcctgaacaaaagaagggtctctgaggagaacttcgtcggcagtgattatggc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003592 |
caagcacggtggttgttgagtcgtcgttacggactcttgcttgaagttcctgaacaaaagaagggtctctgaggagaacttcgtcggcagtgattatggc |
43003691 |
T |
|
| Q |
223 |
ttggatgtgttccacgttgatgatgatg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43003692 |
ttggatgtgttccacgttgatgatgatg |
43003719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University