View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_29 (Length: 244)
Name: NF17814_high_29
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 38826443 - 38826205
Alignment:
| Q |
10 |
attgatttagaaaaggagagaccaatttcgtaaataagagactgaatttaccta--atatatatggtcattggtagatgttttatattat---aattaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
38826443 |
attgatttagaaaaggagagaccaatttcgtaaataagagactgaatttacctataatatatatggtcattggaagatgttttatattattataattaac |
38826344 |
T |
|
| Q |
105 |
annnnnnnngtaagcaacagatatttgcaatgccagtgtttgacatgattgaaaccctcttggttaagcaaatggaatttgcacctacatttgcacttcg |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38826343 |
attttttt-gtaagcaacagatatttgcaatgccagtgtttgacatgattgaaaccctcttggttaagcaaatggaatttgcacctacatttgcactccg |
38826245 |
T |
|
| Q |
205 |
attatcagttcgcacactatatgttggtatgtctacttgt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38826244 |
attatcagttcgcacactatatgttggtatgtctacttgt |
38826205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University