View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_31 (Length: 236)
Name: NF17814_high_31
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 7 - 112
Target Start/End: Original strand, 33433259 - 33433364
Alignment:
| Q |
7 |
ttgtgtgatgcatgtaaatgtgagtaatgctttcttggggatggtgaatatgtttcttgaactattgaattgtgggattggtgtcaatgtgaataacact |
106 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
33433259 |
ttgtgtgatgggtgtaaatgtgagtaacactttcttggggagggtgaatatgtttcttgaactattgaattatgtgattggtgtcaatgtgaataacact |
33433358 |
T |
|
| Q |
107 |
ttcttg |
112 |
Q |
| |
|
|||||| |
|
|
| T |
33433359 |
ttcttg |
33433364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 136 - 206
Target Start/End: Original strand, 33433583 - 33433657
Alignment:
| Q |
136 |
tttgggtctcttcccttcagata----ccttgatccttctggttaacaaggtcagtctcttaaaggaactaacct |
206 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| ||||||| |||||||| |||||| |||| |
|
|
| T |
33433583 |
tttgggtctcttccctttagatatataccttgatccttctggttaataaggtcaatctcttaagggaactgacct |
33433657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University