View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_high_35 (Length: 204)
Name: NF17814_high_35
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 101 - 186
Target Start/End: Complemental strand, 16578536 - 16578451
Alignment:
| Q |
101 |
ttggtttcgttgatgaaaagttcggtgtggggacgtttgttcataaaaccaggtggattacctgacgggtggtggggatgatccac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16578536 |
ttggtttcgttgatgaaaagttcggtgtggggacgtttgttcataaaaccaggtggattacctgacgggtggtggggatgatccac |
16578451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 16578636 - 16578598
Alignment:
| Q |
1 |
tggtcttcctcttggtcttcggtttccaatttcaactgc |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16578636 |
tggtcttcctcttggtcttcggtttccaatttcaactgc |
16578598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 32809719 - 32809752
Alignment:
| Q |
1 |
tggtcttcctcttggtcttcggtttccaatttca |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
32809719 |
tggtcttcctcttggtcttcggttaccaatttca |
32809752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University