View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_low_12 (Length: 465)
Name: NF17814_low_12
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 8e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 8e-96
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 43528302 - 43528117
Alignment:
| Q |
16 |
gtcaacaatttagggttttctctaatttctcaatttagggttttagtgtttcacaatttcttttccattcgatttttaccttatctattcagaatttatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43528302 |
gtcaacaatttagggttttctctaatatctcaatttagggttttagtgtttcacaatttcttttccgttcgatttttaccttatctattcagaatttatt |
43528203 |
T |
 |
| Q |
116 |
actttagggttttcttgaaaacatttctcattttagggttttccctttgatttaattttaccgattcagaatttctcaattcagga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43528202 |
actttagggttttcttgaaaacatttctcattttagggttttccctttgatttaattttaccgattcagaatttctcaattcagga |
43528117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 310 - 460
Target Start/End: Complemental strand, 43528004 - 43527854
Alignment:
| Q |
310 |
tatggattcagaattgctcaattcagggttttgnnnnnnngaaacagttggataggttcataccaaaccgatcagcgatggattttgattacgctcacta |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43528004 |
tatggattcagaattgctcaattcagggttttgtttttttgaaacagttggataggttcataccaaaccgatcagcgatggattttgattacgctcacta |
43527905 |
T |
 |
| Q |
410 |
catgatgatggagggttgtagaaaaggaaaagagaacccagtgatgatgtc |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
43527904 |
catgatgatggagggttgtagaaaaggaaaagagaatccagcgttgatgtc |
43527854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University