View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_low_23 (Length: 360)
Name: NF17814_low_23
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 46 - 356
Target Start/End: Original strand, 47716424 - 47716734
Alignment:
| Q |
46 |
atgggtttgtttgattggttttatggttggttgttgtatataggtagaagttaggaaagcaataccgagaagtgaacagctacaacaaaatcaattacag |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47716424 |
atgggtttgtttgattggttttatggttggttgttgtatataggtagaagttaggaaagcaataccgagaagtgaacagctacaacaaaatcaattacag |
47716523 |
T |
|
| Q |
146 |
aatagaggggggaatagctatagtggttatgaatgtgggaatgaacatattaggactaagaagatttttgtcggtggtttacctgctaatatgtctgtgg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47716524 |
aatagaggggggaatagctatagtggttatgaatgtgggaatgaacatattaggactaagaagatttttgtcggtggtttacctgctaatatgtctgtgg |
47716623 |
T |
|
| Q |
246 |
aggagtttaagaggtactttgagaggttcggtcgaataactgatgtggtggtgatgcaagatagtttaactcataggccgagggggtttgggtttattac |
345 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47716624 |
aggagtttaagaggtactttgagaggtttggtcgaataactgatgtggtggtgatgcaagatagtttaactcataggccgagggggtttgggtttattac |
47716723 |
T |
|
| Q |
346 |
ctttgattctg |
356 |
Q |
| |
|
|||||||||| |
|
|
| T |
47716724 |
ttttgattctg |
47716734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University