View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_low_32 (Length: 264)
Name: NF17814_low_32
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 7624506 - 7624743
Alignment:
| Q |
19 |
gtttgaccatctttcggtttgtcaatctcccttaatgttcttacgacaattttttgttgcctcctagcctttatcaccagttttcatcactaggtttggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624506 |
gtttgaccatctttcggtttgtcaatctcccttaatgttcttacgacaattttttgttgcctcctagcctttatcaccagttttcatcactaggtttggt |
7624605 |
T |
|
| Q |
119 |
catattatcattgatattttaaacttgtttttaatgtatggtccacggtggaccatttatgaacacattgtcatattagaatttgccatccccccatatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7624606 |
catattatcattgatattttaaacttgtttttaatgtatggtccacggtggaccatttatgaacacattgtcatattagaatttgccatccccccatact |
7624705 |
T |
|
| Q |
219 |
gtggcttaaacaacaaacacgtttttatcacctatgct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7624706 |
gtggcttaaacaacaaacacgtttttatcacccatgct |
7624743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University