View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_low_35 (Length: 253)
Name: NF17814_low_35
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 138 - 252
Target Start/End: Original strand, 20039445 - 20039554
Alignment:
| Q |
138 |
acgaaaactgaagatcaacctagacaagggagaggtttacagtgttttggctgtgatggatatggtcatctcatgtctgagtgtcctacttatcacaaga |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
20039445 |
acgaaaactgaagatcaacctag-----ggagaggtttacaatgttttggctgtgatggatatggtcatctcaactccgagtgtcctacttatctcaaga |
20039539 |
T |
|
| Q |
238 |
aacaacaaaaaggtc |
252 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
20039540 |
aacaataaaaaggtc |
20039554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University