View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17814_low_43 (Length: 208)
Name: NF17814_low_43
Description: NF17814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17814_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 6e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 46573934 - 46573828
Alignment:
| Q |
1 |
taaagctaatgcttggtgatattcatcgggagccaaaaggattcttaatacttcttaacaagacataatttgaagnnnnnnntcaaaaccaaaattaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46573934 |
taaagctaatgcttggtgatattcattgggagccaaaaggattcttaatacttcttaacaagacataatttgaagaaaaaaatcaaaaccaaaattaact |
46573835 |
T |
 |
| Q |
101 |
tccttag |
107 |
Q |
| |
|
||||||| |
|
|
| T |
46573834 |
tccttag |
46573828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 46573717 - 46573649
Alignment:
| Q |
132 |
atgtttctataatgttagcttagaacagaaggctgatcagaaacaagagtattccctttaatctgtgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
46573717 |
atgtttctataatgttagcttagaacagaaggctgatcagaaacgagagtattccctttaatttgtgct |
46573649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University