View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17816_low_3 (Length: 323)
Name: NF17816_low_3
Description: NF17816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17816_low_3 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 42336250 - 42335930
Alignment:
| Q |
1 |
ttcaccatcgccactttcatctccgacaccagcccccgctccatctccttccaaccataatgcacctgctccagcaatcaatccaacggcatcatctcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | ||||||| ||||| |||||||| |
|
|
| T |
42336250 |
ttcaccatcgccactttcatctccgacaccagcccccgctccatctacttccaaccataatgcacctgctccagtcaccaatccatcggcaccatctcct |
42336151 |
T |
 |
| Q |
101 |
caaagatctccacccagtccaactcaaggaaactcacctccatcggctacttcgaaaactctagccccaccacctttgaaggggaagaaaatctttggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42336150 |
caaagatctccacccagtccaactcaaggaaactcacctccatcggctacttcgaaaactctagccccaccaccttcgaaggggaagaaaatctttggaa |
42336051 |
T |
 |
| Q |
201 |
agaaggtttgtatatggttcctctttttgttttgtccttacaacatttaacacacacgttggttttgtgcaatgcannnnnnnnnacttcccttgaatat |
300 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42336050 |
agaaggtttg--tatggttcctctttttgttttgtccttacaacatttaacacacaagttggttttgtgcaatgcatttttttttacttcccttgaatat |
42335953 |
T |
 |
| Q |
301 |
atgtttttgttcgtcgcaatttt |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42335952 |
atgtttttgttcgtcgcaatttt |
42335930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University