View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_high_17 (Length: 331)
Name: NF17817_high_17
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 11 - 315
Target Start/End: Original strand, 16845251 - 16845554
Alignment:
| Q |
11 |
cacagacattcactcactcagaaaatcataactcccaccttcactttcaatcaataattactttactgtagtatatatacggcatatgcagtactcattt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16845251 |
cacacacattcactcactcagaaaatcataactcccaccttcactttcaatcaataattactttactgtagtatatatacggcatatgcagtactcatct |
16845350 |
T |
|
| Q |
111 |
attacattcatcaattcactgattcaataaatatttacactcatgtcagtttaagttttaactctctttctgactttgatcaccaaacacaaactcacct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16845351 |
attacattcatcaattcactgattcaataaatatttacattcatgtcagtttaagttttaactctctttctgactttgatcaccaaacacaaactcacct |
16845450 |
T |
|
| Q |
211 |
aaccttttattgtctctttttaattatactgagctttcatttaacccacatagtttatctccaatctatcgactcttcttaaacctcataaatctacgta |
310 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||| ||| |||||||||||||||||| |
|
|
| T |
16845451 |
aacctttt-ttgtctctttttaattatattgagctttcatttaacccacatagtttatctccaatctattgacccttgttatacctcataaatctacgta |
16845549 |
T |
|
| Q |
311 |
taact |
315 |
Q |
| |
|
||||| |
|
|
| T |
16845550 |
taact |
16845554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University