View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_high_37 (Length: 204)
Name: NF17817_high_37
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_high_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 48254923 - 48254801
Alignment:
| Q |
1 |
caaaatgatttcacttccaacctagcagtcattggcacaggtggtgtgcaagagtttctccctcaagttgtttcacaaattgccgctaccattaaagtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48254923 |
caaaatgatttcacttccaacctagcagtcattggcacaggtggtgtgcaagagtttctccctcaagttgtttcacaaattgccgctaccattaaagtaa |
48254824 |
T |
|
| Q |
101 |
gagtaacttatgtctattagtta |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48254823 |
gagtaacttatgtctattagtta |
48254801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 6 - 118
Target Start/End: Original strand, 39282245 - 39282357
Alignment:
| Q |
6 |
tgatttcacttccaacctagcagtcattggcacaggtggtgtgcaagagtttctccctcaagttgtttcacaaattgccgctaccattaaagtaagagta |
105 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||| | ||||| |||| ||| | || |||| ||||||| ||||| || |||||||| ||||| || |
|
|
| T |
39282245 |
tgatttcacttccaacgtagcagtcatcggcataggtagagtgcacgagtatctgcttctagttatttcacagattgctgccaccattaaggtaaggata |
39282344 |
T |
|
| Q |
106 |
acttatgtctatt |
118 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
39282345 |
ccttatgactatt |
39282357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University