View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_low_23 (Length: 307)
Name: NF17817_low_23
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 293
Target Start/End: Original strand, 49816884 - 49817165
Alignment:
| Q |
12 |
aagaattgtagagaacgaatcaatctattttgacgagctgtatcgaaattcaaactgctgcttcttttgaattgccagaaatgtttggataacaatggct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49816884 |
aagaattgtagagaacgaatcaatctattttgacgagctgtatcaaaattcaaactgctgcttcttttgaattgccagaaatgtttggataacaatggct |
49816983 |
T |
 |
| Q |
112 |
tctcttcttccacgtctgtttcatcagacagaaattctttaagcctcttcttcattactgtagttttttgaagaggctcaaagagttcattagctgatga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49816984 |
tctcttcttccacgtctgtttcatcagacaggaattctttaagcctcttcttcattactgtagttttttgaagaggctcaaagaattcattagctgatga |
49817083 |
T |
 |
| Q |
212 |
atttttctttattggaacgataattccattggagataacnnnnnnnatttccattggaactatttttccatcggagaaaagt |
293 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49817084 |
atttttcttcattggaacgataattccattggagataactttttttatttccattggaactatttttccatcggagaaaagt |
49817165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University