View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_low_31 (Length: 244)
Name: NF17817_low_31
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 5922773 - 5923002
Alignment:
| Q |
1 |
gaaagtttttataaataagaaggtttatattgagttttaatttcttcactacaacaactctagtccattattag-----cttgagta--gttgtgtgttc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5922773 |
gaaagtttttataaataagaaggtttatattgagttttaatttcttcactacaacaactctagtccattattaggtgagcttgagtatagttgtgtgttc |
5922872 |
T |
|
| Q |
94 |
tcaaaaggtttgcaaattttcggtcaactaacatcagagtaaaggttcagactaaggatgaaagataagttgcgtcatgcatttaaagagagatgagtta |
193 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5922873 |
tcaaaaggtttacaaattttcggtcaactaacatcagagtaaaggttcagacaatggatgaaagataagttgcgccatgcatttaaagagagatgagtta |
5922972 |
T |
|
| Q |
194 |
tcatatttgtattttttcttagatagtgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5922973 |
tcatatttgtattttttcttagatagtgtt |
5923002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University