View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_low_32 (Length: 237)
Name: NF17817_low_32
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 50152765 - 50152969
Alignment:
| Q |
18 |
atgaatgtagtcacatgtgtcaatgtcatgtcggagataccaacatgcgtcgaacatcggacagttcgatcaaaggtgtcggtgttacata----ctcac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
50152765 |
atgaatgtagtcacatgtgtcaatgtcatgtcggagataccaacatgcatcggacaccggacagttcgatcaaag-tgtcggtgttacatagatactcac |
50152863 |
T |
 |
| Q |
114 |
taatgtatgaacactatagtgagtgtttgtaccctcttagaagtttggcacaaagctatgaaatgattcatttattctattgcaaaggactcagaattct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50152864 |
taatgtatgaacactatagtgagtgtttgtaccctcttagaagtttggcacaaagatatgaaatgattcatttattctattgcaaaggactcaaaattct |
50152963 |
T |
 |
| Q |
214 |
tgccct |
219 |
Q |
| |
|
|||||| |
|
|
| T |
50152964 |
tgccct |
50152969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University