View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_low_34 (Length: 232)
Name: NF17817_low_34
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 44 - 210
Target Start/End: Original strand, 124436 - 124602
Alignment:
| Q |
44 |
taccagagcccatagattcacgctgagacttattctgccaaggaagcaaataattaggactgcatgaaacagtgaaaatcttgacaacagaattgaaagc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
124436 |
taccagagcccatagattcacgctgagatttgttctgccaaggaagcaaataattaggactgcatgaaacagtgaaaatcttgacaacggaattgaaagc |
124535 |
T |
 |
| Q |
144 |
aagctcaacagcagtattagtagtatgtgtcaatgcggcggcgctgcgtggttgaatcttcttcctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
124536 |
aagctcaacagcagtattagtagtatgtgtcaatgcggcggcgctacgtggttgaatattcttcctt |
124602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University