View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17817_low_34 (Length: 232)

Name: NF17817_low_34
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17817_low_34
NF17817_low_34
[»] chr6 (1 HSPs)
chr6 (44-210)||(124436-124602)


Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 44 - 210
Target Start/End: Original strand, 124436 - 124602
Alignment:
44 taccagagcccatagattcacgctgagacttattctgccaaggaagcaaataattaggactgcatgaaacagtgaaaatcttgacaacagaattgaaagc 143  Q
    |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
124436 taccagagcccatagattcacgctgagatttgttctgccaaggaagcaaataattaggactgcatgaaacagtgaaaatcttgacaacggaattgaaagc 124535  T
144 aagctcaacagcagtattagtagtatgtgtcaatgcggcggcgctgcgtggttgaatcttcttcctt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||    
124536 aagctcaacagcagtattagtagtatgtgtcaatgcggcggcgctacgtggttgaatattcttcctt 124602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University