View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_low_38 (Length: 222)
Name: NF17817_low_38
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 26 - 209
Target Start/End: Original strand, 6924624 - 6924807
Alignment:
| Q |
26 |
aatgaatatgagattttgtttggttattatgctagctactacaatttttataattggtgggggaccatgttttcttgttttagatctctcttctccacac |
125 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6924624 |
aatgaataagagattttgtttggttattatgctagctactacaatttttataattggtgggggaccatgttttcttgttttagatctctcttctccacac |
6924723 |
T |
 |
| Q |
126 |
ccattggctgtcactgcacattatttatgcctgcaatgttttgggaacgttaaataataatcccttcttacaacatatatatat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6924724 |
ccattggctgtcactgcacattatttatgcctgcaatgttttgggaacgttaaataataatcccttcttacaacatatatatat |
6924807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University