View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17817_low_41 (Length: 207)
Name: NF17817_low_41
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17817_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 24160376 - 24160199
Alignment:
| Q |
12 |
tgagatgaatccagacaggtttttaaggtcacaatatgttaaagaccgact-tgtgagccacaagttggcctgcatcttgaactcaggaaccagatatta |
110 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
24160376 |
tgagttgaatccagacaggtgtttaaggtcacaatatgttaaagaccgactatgtgagccacaagtcggcatgcatcttgaactcaggaaccagatatta |
24160277 |
T |
|
| Q |
111 |
ccgattggtgagacaaacccgtcttgctatttcatgccctgcaaggatcataataaagaagtgaaatttgttgatccc |
188 |
Q |
| |
|
||||||||||||||||| | ||| ||||| |||| | ||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24160276 |
ccgattggtgagacaaattcatctggctatatcatacactgcaaggatcataaaaaagaagtgatatttgttgatccc |
24160199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University