View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17817_low_41 (Length: 207)

Name: NF17817_low_41
Description: NF17817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17817_low_41
NF17817_low_41
[»] chr7 (1 HSPs)
chr7 (12-188)||(24160199-24160376)


Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 24160376 - 24160199
Alignment:
12 tgagatgaatccagacaggtttttaaggtcacaatatgttaaagaccgact-tgtgagccacaagttggcctgcatcttgaactcaggaaccagatatta 110  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||    
24160376 tgagttgaatccagacaggtgtttaaggtcacaatatgttaaagaccgactatgtgagccacaagtcggcatgcatcttgaactcaggaaccagatatta 24160277  T
111 ccgattggtgagacaaacccgtcttgctatttcatgccctgcaaggatcataataaagaagtgaaatttgttgatccc 188  Q
    |||||||||||||||||  | ||| ||||| |||| | ||||||||||||||| |||||||||| |||||||||||||    
24160276 ccgattggtgagacaaattcatctggctatatcatacactgcaaggatcataaaaaagaagtgatatttgttgatccc 24160199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University