View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17818_high_3 (Length: 396)

Name: NF17818_high_3
Description: NF17818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17818_high_3
NF17818_high_3
[»] chr2 (2 HSPs)
chr2 (20-111)||(402080-402171)
chr2 (311-389)||(402171-402249)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 402080 - 402171
Alignment:
20 tctggctcaaatgtcaaagatccggcgaacaggctacgaaaatgcattacagtttagaaattcaccaagaaaaatcagggtgggggatagag 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
402080 tctggctcaaatgtcaaagatccggcgaacaggctacgaaaatgcattacagtttagaaattcaccaagaaaaatcagggtgggggatagag 402171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 311 - 389
Target Start/End: Original strand, 402171 - 402249
Alignment:
311 gcgttttgtagtcagcttgtataattggtgtaacttatcaagatattcggcttttgccatattattaatagtattatct 389  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||    
402171 gcgttttgtagtcagcttgtataattggtgtaacttatcaagatattcagcttttgccatattattaatagtatcatct 402249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University