View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17818_high_3 (Length: 396)
Name: NF17818_high_3
Description: NF17818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17818_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 402080 - 402171
Alignment:
| Q |
20 |
tctggctcaaatgtcaaagatccggcgaacaggctacgaaaatgcattacagtttagaaattcaccaagaaaaatcagggtgggggatagag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
402080 |
tctggctcaaatgtcaaagatccggcgaacaggctacgaaaatgcattacagtttagaaattcaccaagaaaaatcagggtgggggatagag |
402171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 311 - 389
Target Start/End: Original strand, 402171 - 402249
Alignment:
| Q |
311 |
gcgttttgtagtcagcttgtataattggtgtaacttatcaagatattcggcttttgccatattattaatagtattatct |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
402171 |
gcgttttgtagtcagcttgtataattggtgtaacttatcaagatattcagcttttgccatattattaatagtatcatct |
402249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University