View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17818_high_5 (Length: 336)
Name: NF17818_high_5
Description: NF17818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17818_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 25928403 - 25928662
Alignment:
| Q |
9 |
acatcatcaaaactcaattctagttcttcgcacttctatgtatcaatttaatacgatggatatcacttcatttatcaactnnnnnnnnnnnnncaatcaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25928403 |
acatcatcaaaactcaattctagttcttcgcacttctatgtatcaatttaatacgatggatatcacttcatttatcaactaaaaaacaaaaaacaatcaa |
25928502 |
T |
|
| Q |
109 |
tagtgtaatatgaaaaccgatacctcacaataggatttt-----------------acaaggactttctctagatttttaaggatctttgggctgatggg |
191 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| || | |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25928503 |
tagtgtaatatgaaaatcgatacctcacaataggattttgctgaattgaaaacattactatgactttctctagatttttaaggatctttgggcagatggg |
25928602 |
T |
|
| Q |
192 |
gccatatggacacttgtcgaaatgcaatgttttggcccctcggtcacaacactcgtgatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
25928603 |
gccatatggacacttgtcgaaatgcaatgttttggtccctcagtcacaacactcgtgatt |
25928662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University