View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17818_high_6 (Length: 257)
Name: NF17818_high_6
Description: NF17818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17818_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 21181699 - 21181471
Alignment:
| Q |
19 |
taacaacacttgttacaccaattgttcttgtgttgcttatgcttatgattttaacggcaactgcaagttgtggaatgatcaagtacagactctgaagaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21181699 |
taacaacacttgttacaccaattgttcttgtgttgcttatgcttatgattttaacggcaactgcaagttgtggaatgatcaagtacagactctgaagaac |
21181600 |
T |
|
| Q |
119 |
atctcaactgatattcaagacggtaataataataataaaccaaatttttatctcagacttgctggctcagacttgcttcccccaagtaagttgaaggaac |
218 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21181599 |
atctcaactgaaattcaagaccgtaataata---ataaaccaaatttttatctcagacttgctggctcggacttgcttcccccaagtaagttgaaggaac |
21181503 |
T |
|
| Q |
219 |
ctactttatctttccttttctttttcatatca |
250 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| |
|
|
| T |
21181502 |
ctactttacctttccttttcttttttatatca |
21181471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 41 - 129
Target Start/End: Original strand, 23187428 - 23187519
Alignment:
| Q |
41 |
tgttcttgtgttgcttatgcttatgatttt---aacggcaactgcaagttgtggaatgatcaagtacagactctgaagaacatctcaactga |
129 |
Q |
| |
|
|||||||||||| ||||||||||||| || ||||| ||||||| | |||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
23187428 |
tgttcttgtgttctttatgcttatgatatttctaacggtaactgcatgctgtggaatgatcaagtaccgactctgaagaacacctcgactga |
23187519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 39 - 111
Target Start/End: Original strand, 23178273 - 23178348
Alignment:
| Q |
39 |
attgttcttgtgttgcttatgcttatgatttta---acggcaactgcaagttgtggaatgatcaagtacagactct |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||| ||||| ||| |||||||||||||||| |||||| |
|
|
| T |
23178273 |
attgctcttgtgttgcttatgcttatgatttttttgacggtgcctgcatgttatggaatgatcaagtaccgactct |
23178348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University