View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17818_low_6 (Length: 336)

Name: NF17818_low_6
Description: NF17818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17818_low_6
NF17818_low_6
[»] chr3 (1 HSPs)
chr3 (9-251)||(25928403-25928662)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 25928403 - 25928662
Alignment:
9 acatcatcaaaactcaattctagttcttcgcacttctatgtatcaatttaatacgatggatatcacttcatttatcaactnnnnnnnnnnnnncaatcaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||             |||||||    
25928403 acatcatcaaaactcaattctagttcttcgcacttctatgtatcaatttaatacgatggatatcacttcatttatcaactaaaaaacaaaaaacaatcaa 25928502  T
109 tagtgtaatatgaaaaccgatacctcacaataggatttt-----------------acaaggactttctctagatttttaaggatctttgggctgatggg 191  Q
    |||||||||||||||| ||||||||||||||||||||||                 || | |||||||||||||||||||||||||||||||| ||||||    
25928503 tagtgtaatatgaaaatcgatacctcacaataggattttgctgaattgaaaacattactatgactttctctagatttttaaggatctttgggcagatggg 25928602  T
192 gccatatggacacttgtcgaaatgcaatgttttggcccctcggtcacaacactcgtgatt 251  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||    
25928603 gccatatggacacttgtcgaaatgcaatgttttggtccctcagtcacaacactcgtgatt 25928662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University