View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1781_high_3 (Length: 313)
Name: NF1781_high_3
Description: NF1781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1781_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 854353 - 854150
Alignment:
| Q |
19 |
gaagaatatggtgaaacctgagaatgatgatactgtttctggaactagcagaagaaatcaatcaggaaatgccaacatgaagggaggaaaagggtcattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
854353 |
gaagaatatggtgaaacctgagaatgatgatactgtttctggaactagcagaagaaatcaatcaggaaatgccaacatggagagaggaaaagggtcattt |
854254 |
T |
 |
| Q |
119 |
caattagtaacgggcaaggtactttaatatgaatttatgataatgaatcaatgatcatattaatgcttttattttactgcttcactgatttttgttcata |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
854253 |
caattagtaactggcaaggtactttaatatgaacttatgataatgaatcaatgatcatattagtgcttttattttactgcttcactgatttttgttcata |
854154 |
T |
 |
| Q |
219 |
aaaa |
222 |
Q |
| |
|
|||| |
|
|
| T |
854153 |
aaaa |
854150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University